Introduction
Aflatoxins are highly toxic secondary metabolites that emanate mainly from filamentous fungi Aspergillus flavus and Aspergillus parasiticus in agricultural and food products [ 1 , 2 ]. These secondary metabolites constitute the etiology of a wide range of carcinogenic, mutagenic, and deleterious complications in humans and various animals [ 3 , 4 ]. There are at least 20 known fungal metabolites, 14 of which are primarily studied as typical aflatoxins. Only six of them, namely aflatoxins B1, B2, G1, G2, M1, and M2, can be found typically in food [ 5 , 6 ]. Aflatoxin B1 (AFB1), the most toxic one, is produced by A. flavus and A. parasiticus. The liver is the main target of aflatoxins. The consumption of contaminated food over an extended period of time may lead to adverse consequences for the liver, including damage to hepatic tissues and cells that become visible or remain microscopic. AFB1 is shown as a significant immunosuppressive, hepatotoxic, teratogenic, and mutagenic agent [ 2 , 5 ].
Approximately 30 genes are thought to be involved in the biosynthesis of aflatoxins. The number of genes and corresponding enzymes has reportedly increased over time. Aflatoxin pathway genes in A. flavus and A. parasiticus are clustered within a 75-kbp. The DNA sequence containing the 25 genes or open reading frames represents a well-defined aflatoxin pathway gene cluster [ 6 - 8 ]. Since the discovery of aflatoxins, extensive and costly efforts have been made to identify and monitor the presence of aflatoxins in food products, while primarily aiming to establish strategies for their control [ 9 - 11 ]. To detect aflatoxins, several highly accurate methods have been developed, including high-performance liquid chromatography (HPLC), gas chromatography-mass spectrometry, and immunoassay-based assays. Meanwhile, usually, detection of aflatoxin-producing fungi depends on isolation protocols and culture methods which are both time-consuming and require taxonomic expertise [ 4 , 12 , 13 ].
A group-specific assay was described for the detection of aflatoxin-producing species by monitoring several aflatoxin biosynthesis genes, including aflatoxin regulatory (aflR), o-methyl transferase (omt), norsolorinic acid reductase (nor1) and versicolorin A dehydrogenase (ver-1) [ 14 , 17 - 19 ]. Both systems revealed an expected triplet pattern for aflatoxigenic strains of A. flavus and A. parasiticus, indicating the presence of all three targeted biosynthetic genes in these strains. According to the literature, about 40-50% of isolated A. flavus strains produce aflatoxin. This inability to synthesize aflatoxin could be a result of gene deletions or other mutations in aflatoxin biosynthetic genes [ 6 , 8 ].
Usefulness of PCR methods to monitor the quality and safety of agricultural commodities can be well exploited to differentiate the toxigenic and non-toxigenic strains [ 17 , 18 ]. Several multiplex PCR systems have been developed recently for the detection of aflatoxin-producing fungi [ 14 - 20 ]. The multiplex PCR is a rapid method for identifying and monitoring aflatoxigenicity in A. flavus which employs a combination of primer sets to generate amplicons of various sizes that are specific for various DNA sequences.
In the present study, multiplex PCR, as a genome-based method, was used for the detection of aflatoxin-producing A. flavus strains isolated from pistachio orchard soil for the first time in Iran. Two chromatographic techniques, namely thin layer chromatography (TLC) and HPLC were used for the qualitative and quantitative assay of AFB1 produced by examined strains.
Materials and Methods
Fungal strains and cultures
The present study was performed on A. flavus PTCC5004, (AFB1-producing standard strain) and 25 isolates of A. flavus isolated from soils of pistachio orchards obtained from the Pathogenic Fungi Culture Collection of the Pasteur Institute of Iran [ 13 ]. All fungal strains were cultured on sabouraud dextrose agar (SDA, Merck, Germany) and kept at 28 °C for 4-5 days. The fungal spores were collected using a sterile tween 80 solution, 0.1% (v/v), washed three times, and counted. The 5×103 spore/ml were cultured in 100 ml erlenmeyer flasks containing 25 ml YES (yeast extract 2% and sucrose 15%) broth in an orbital shaker (150 rpm) for 3 days at 28 °C. Fungal mycelia were separated through Whatman No.1 filter paper. Each fungal mycelia were washed three times with sterilized and deionized water and kept at -80 °C for the next DNA extraction step. The filtrated cultures were stored at -20 °C for AFB1 determination [ 13 ].
Qualitative measurement of Aflatoxin B1 by thin-layer chromatography
For qualitative measurement of AFB1 by TLC technique, 10 ml of the YES medium form 3 days fungal culture were mixed with 10 ml of chloroform (Merck, Germany). The chloroformic extracts were concentrated by a rotary evaporator (EYELA N-1000, Japan) until dry. The residue was dissolved in 1 ml methanol (Merck, Germany), and 5 µl of samples were spotted on silica gel 60 F254 plates (E. Merck, Germany) comparing AFB1 standard (1 ρg/ml). The plates were developed with a mixture of chloroform and methanol (98:2 v/v) and visualized under UV light (365 nm). The intensity and Rf values of the spots were compared to those of the AFB1 standard that appears as blue fluorescent spots [ 21 ].
Quantitative measurement of Aflatoxin B1 by high‐performance liquid chromatography
Quantitation of AFB1 was carried out using HPLC (KNAUER D-14163 UV-VIS system, Germany). Briefly, 50 µl of each of the chloroformic extracts sample was injected into the HPLC C18 reverse phase column (TSKgel ODS-80TS; 4.6 mm ID × 150 mm, Tosoh Bioscience, Japan) and eluted at a flow rate of 1 ml/min by water-acetonitrile-methanol (60:25:15, v/v/v). The amount of AFB1 was measured at a wavelength of 365 nm using a fluorescence detector. A standard curve of AFB1 was plotted using various concentrations of AFB1 standard (1, 5, and 10 mg), and the amounts of AFB1 in unknown samples were calculated by comparison of the undercurved areas of the samples with authentic standards. The elution time of the samples was compared with pure AFB1 retention time (12.25 min) and quantified based on the ratio of the peak area of samples to those of the standards [ 21 ].
DNA extraction and qualification
Total DNA was extracted from three-day-old mycelia grown on YES as described above. Fungal mycelia were thoroughly ground in a porcelain mortar and 10-50 mg homogeneity of the fungus was poured into a 1.5 ml tube. The DNA was extracted with a commercial kit from Qiagen (QIAamp DNA MiniKit; Qiagen, Germany) according to the instructions of the manufacturer. Afterward, 300 μl of lysis buffer (100 mM Tris, pH 8, 10 mM ethylene-diamine-tetraacetic acid [EDTA], 100 mM NaCl, 1% sodium dodecyl sulfate, and 1% Triton X-100) was mixed with 300 μl phenol-chloroform, vortexed, and centrifuged at 5, 000×g for 5 min. Isopropanol was added to the supernatant at the same volume, and the tube was incubated at -20 °C for 20 min followed by centrifugation at 12, 000×g for 10 min. The precipitate was washed with cold 70% ethanol, dried, and dissolved in 50 μL of TE buffer (10 mM Tris, 1 mM EDTA). To ensure DNA extraction, 5 μl of the extracted solution was electrophoresed on 1% agarose gel. Presence of a band at the top of the gel indicated the presence of DNA. Its optical density was determined at 260 and 280 nm [ 22 ].
Primer design
Reliable sequences of several molecular identification targets were downloaded from the National Center for Biotechnology Information (https://www.ncbi.nlm.nih.gov/pubmed/) (Table 1). They included one regulatory (aflR) and three structural (omtA, omtB, and ver-1) genes in the aflatoxin gene cluster of A. flavus which were targeted for aflatoxin production [ 17 ]. Primer design for multiplex PCR application was performed by Ultiplex software (http://ultiplex.igenebook.cn), assessing critical factors, such as compatibility of the primers. It should also be noted that the production of additional bands or spurious hybridizations of primer pairs to each other in amplification reactions was avoided. The oligonucleotide primers were synthesized by Nedayefan Co., Iran.
Aspergillus flavus strains | AFB1 assay (ng/mg fungal dried weight) | AFB1 detection by TLC | omtA | omtB | ver-1 | aflR |
---|---|---|---|---|---|---|
A. flavus 255 | 41.2±0.2 | + | + | + | + | + |
A. flavus 267 | 75.7±11.8 | + | + | + | + | + |
A. flavus 137 | 321.6±55.0 | + | + | + | + | + |
A. flavus 191 | 33.1±0.6 | + | + | + | + | + |
A. flavus 193 | 72.7±0.5 | + | + | + | + | + |
A. flavus 288 | 51.6±0.3 | + | + | + | + | + |
A. flavus 116 | 31.8±8.1 | + | + | + | + | + |
A. flavus 186 | 29.5±0.5 | + | + | + | + | + |
A. flavus 309 | 40.4±10.2 | + | + | + | + | + |
A. flavus 285 | 1.2±0.2 | +/- | - | + | + | + |
A. flavus 83 | 0.0 | - | + | + | + | - |
A. flavus 86 | 0.0 | - | + | + | + | - |
A. flavus 101 | 108.6±14.0 | + | + | + | + | + |
A. flavus 209 | 140.6±14.7 | + | + | + | + | + |
A. flavus 244 | 2.2±0.4 | +/- | - | + | + | + |
A. flavus 224 | 19.1±0.3 | + | + | + | + | + |
A. flavus 165 | 122.6±0.7 | + | + | + | + | + |
A. flavus 154 | 0.0 | - | - | + | + | - |
A. flavus 213 | 44.1±1.2 | + | + | + | + | + |
A. flavus 313 | 14.0±3.0 | + | + | + | + | + |
A. flavus 417 | 45.0±3.0 | + | + | + | + | + |
A. flavus 425 | 2.5±0.2 | +/- | - | + | + | + |
A. flavus 472 | 36.0±2.0 | + | + | + | + | + |
A. flavus 488 | 2.0±0.5 | +/- | - | + | + | + |
A. flavus 494 | 55.6+3.0 | + | + | + | + | + |
A. flavus 5004 | 255.6±10.2 | + | + | + | + | + |
TLC: thin layer chromatography, AFB1: Aflatoxin B1, aflR: aflatoxin regulatory, omt: o-methyl transferase, ver-1: versicolorin A dehydrogenase |
Multiplex polymerase chain reaction
Multiplex PCR amplification was set up and performed on the DNA extracted from all fungal isolates under the following thermal conditions: 5 min at 95 °C followed by 35 cycles of 30 s at 95 °C, 30 s at 65 °C, and 30 s at 72 °C and a final extension step for 2 min at 72 °C [ 17 , 19 ]. The reaction mixture contained 7.5 µl of 2× PCR master mix (Ampliqon, Denmark), 10 pmol of each primer, and 2 µl of DNA template, and reached a total volume of 15 µl by distilled water. The positive and negative controls were included in each amplification reaction. The PCR products were placed into loading STAR (Dyne Bio, Korea) for electrophoresis in 1× Tris-acetate-EDTA buffer on 2.0% agarose gel. Finally, the PCR product banding patterns were analyzed and compared to a DNA ladder (100 bp) (Table 2).
Primer | Sequence [5'- 3'] | Amplicon size (bp) | References |
---|---|---|---|
omtB-F | GCCTTGACATGGAAACCATC | 1333 | [ 17 ] |
omtB-R | CCAAGATGGCCTGCTCTTTA | ||
aflR-F | TATCTCCCCCCGGGCATCTCCCGG | 1032 | [ 17 ] |
aflR-R | CCGTCAGACAGCCACTGGACACGG | ||
ver-1-F | ATGTCGGATAATCACCGTTTAGATGGC | 895 | [ 17 ] |
ver-1-R | CGAAAAGCGCCACCATCCACCCCAATG | ||
omtA-F | GTGGACGGACCTAGTCCGACATCAC | 797 | [ 17 ] |
omtA-R | GTCGGCGCCACGCACTGGGTTGGGG |
Statistical analysis
Descriptive statistics were performed in GraphPad Prism software (ver. 9.5.0.). Analysis of variance test was used as required to compare categorical variables. The P-values of less than 0.05 were considered statistically significant.
Results
Aflatoxin B1 production assay
The results of the HPLC analysis regarding the mean level of AFB1 produced by toxigenic isolates on YES broth are summarized in Table 1. Comparison of AFB1 production of A. flavus strains showed that the range of toxin production was between 0-321.6 (ng/mg fungal dried weight). Aspergillus flavus strains were classified into four groups according to their AFB1 toxin production, including non-producers, low producers, intermediate producers, and high producers. The strains that produced no AFB1 were assigned to Group A, low producer strains that produced between 0.1 and 10 ng/mg AFB1 were assigned to Group B, intermediate producer strains that produced between 10.1 and 100 ng/mg AFB1 were classified as Group C, and high producer strains that produced more than 100 ng/mg AFB1 were categorized as Group D. Except for samples 83, 86, and 154, all the other tested strains were positive for aflatoxin production in TLC analysis. This finding was validated by the HPLC method and the values were determined precisely (Table 1).
Multiplex polymerase chain reaction
The Multiplex PCR method yielded successful results in the analysis of the primers of omtA, omtB, ver-1, and aflR genes involved in the aflatoxin biosynthetic pathway. According to the multiplex PCR results, aflatoxin-producing A. flavus strains isolated from pistachio orchards soil performed all four bands in both sets of primers. Generally, 18 out of the 25 A. flavus (72%) demonstrated all four primer-related bands in moderate and high aflatoxin-producing strains (Figure 1).
Figure 1. Detection of Aspergillus flavus isolates producing aflatoxin B1 using the multiplex-polymerase chain reaction method. Lane 1: A. flavus 425, Lane 2: A. flavus 488, Lane 3: A. flavus 154, Lane 4: A. flavus 186, Lane 5: A. flavus 5004, Lane 6: Ladder (100 bp).
However, in four low toxin-producing A. flavus strains (16%) (244, 285, 425, and 488), despite the presence of the toxin being detected by HPLC, one of omtA, or aflR band did not present in the multiplex PCR. Moreover, the non-aflatoxin-producing A. flavus strains were incapable of generating one or two bands belonging to omtA or aflR (Figure 1).
Positive and negative controls were used for the assessment of the precision and accuracy of the respective methods. In the three non-aflatoxin-producing A. flavus strains (83, 86, and 154) (12%), the results showed that the band belonged to aflR as a regulatory gene was absent in strain number 83 and 86 although both omtA and aflR bands were not present in A. flavus 154. Patterns of the resultant bands can be classified into three broad categories (Figure 2).
Figure 2. Dendrogram using multiplex polymerase chain reaction bands and the resultant classification between the binding patterns categories and toxin production.
Discussion
As aflatoxins are generally known to have toxic, carcinogenic, mutagenic potential activities, there is an urgent need to develop rapid and highly specific detection methods that are capable of precisely differentiating non-toxigenic from toxigenic strains with a reasonable duration [ 2 , 5 ]. The analytical methods, such as TLC and HPLC, are considered gold standard methods and therefore, have been assigned the most amount in various research projects [ 4 , 5 ]. However, these advanced physicochemical methods have some disadvantages. For instance, they are time-consuming for extensive preparation of samples and need very expensive equipment and an expert force that can measure the amount of toxins with these two methods since not every laboratory is able to use these two methods.
Detection of aflatoxigenic Aspergilli strains using PCR was reportedly described for monitoring food and feed quality and safety [ 12 - 16 ]. Multiplex PCR is used for simultaneous amplification of multiple targets/loci and is applied as a diagnostic tool to detect multiple gene mutations [ 23 ]. The mentioned limitations made us investigate the possibility of using the multiplex PCR method as an alternative to these two reference methods to differentiate our isolated toxigenic and non-toxigenic A. flavus strains.
In this study, the multiplex PCR method was used for the first time to monitor aflatoxin-producing ability in A. flavus strains isolated from pistachio orchard soil by analysis of the four aflatoxin biosynthetic pathway genes, namely aflR, omtB, omtA, and ver-1. The aflR and omt gene primers were used since aflR gene regulates the expression of omt gene, a structural gene enclosed in the aflatoxin (AF) biosynthetic pathway, and omt gene is necessary for almost the final formalities of AF biosynthesis [ 7 - 9 ]. The presence of these two genes clearly indicates the aflatoxin production machinery and the detection of aflatoxigenic strains with bands corresponding to aflR and omt genes confirms the identity of the invading genus [ 17 , 23 ].
According to the determination of AFB1 production using TLC and HPLC methods, A. flavus strains were divided into four categories, namely high, moderate, low, and non-toxin producers. The multiplex PCR assay results showed that AFB1-producing A. flavus strains revealed all four bands (1333, 1032, 895, and 797 bp) in both sets of primers and non-toxic strains failed to produce at least one of the four bands. In AFB1 non-producer A. flavus strains 83 and 86, the band of aflR as the regulatory gene was not observed. Moreover, the band that represented the omtA gene was missing in AFB1 non-producer A. flavus strain 154 and low producer A. flavus strain 244 could be attributed to the mutation in omtA gene.
Among the 22 positive strains that were analyzed using HPLC and TLC methods, all four multiplex bands were clearly visible in 18 strains. Nevertheless, regarding 4 out of the 22 strains, one of omtA or aflR bands or both of them were not present in the multiplex PCR. However, in some non-toxigenic and low toxin-producing A. flavus strains, the band that represented the omt-A and aflR genes was missing, whereas all four bands were observed in moderate and high toxigenic A. flavus strains. Aspergillus flavus strains, which were incapable of producing toxins, had a mutation in at least one of the relevant genes, thereby causing the absence of at least one band in the Multiplex PCR. The absence of bands that indicated no AFB1 production by some strains can be considered in line with previous findings of corroborative indications where a lack of aflatoxin biosynthesis occurred occasionally due to genetic mutations.
In similar studies, the Multiplex PCR method was used for the detection of the AFB1 toxin in various agricultural and horticultural products, including Meju and Korean fermented foods and seeds [ 17 ]. Application of the multiplex PCR method for the detection of aflatoxin in Meju showed an increase in the accuracy and speed of aflatoxin detection. Latha et al. in their study showed that aflR, nor-1, ver-1, and omt4 primer pairs gave specific multiplex PCR amplification and could be used as a marker to clearly differentiate between the aflatoxin-producing and non-aflatoxigenic Aspergilli [ 23 ]. In similar research, Criseo et al. studied the differences between aflatoxin-producing and non-producing A. flavus group [ 19 ]. They obtained a four-band pattern for all producers and a variable pattern for non-producers of aflatoxin and suggested that the lack of aflatoxin production apparently does not need to be related to an incomplete pattern obtained in quadruplex PCR. It can be concluded that different types of mutations may be responsible for the inactivation of the AF biosynthetic pathway genes in other A. flavus strains as was indicated by the results of the present study [ 23 ].
The non-toxigenic A. flavus strains showed variable results in the PCR assay. Aspergillus flavus BFE310 was negative in all three PCR assays, indicating a deletion of the whole or a major part of the aflatoxin biosynthetic gene cluster [ 15 ]. Specifically, A. flavus BFE311 showed negative results for the omtA gene primer pair, indicating a deletion in this gene. However, A. flavus BFE301 tested positive for the complete triplet pattern, indicating another type of mutation, possibly in a regulatory gene. It seems that all genes involved in aflatoxin production are clustered together, and the deletion of one gene would almost certainly disrupt aflatoxin biosynthesis [ 7 , 8 , 16 ].
Five genes, including, aflR, aflS, aflD, aflO, and aflQ were determined from various aflatoxigenic strains of A. flavus. This protocol shows a good correlation between the expression patterns of AF biosynthetic pathway genes, analyzed by multiplex reverse transcription-PCR (RT-PCR) and aflatoxin production [ 20 ]. False-positive results are obtained from food samples when several non-aflatoxigenic Aspergillus strains have distinct target gene deletion patterns in the same pistachio sample [ 20 ]. When screening pistachios for aflatoxigenic fungi for diagnostic purposes, false-positive results are usually regarded as less troublesome than false-negative results. The latter may have severe consequences for human health. In this regard, a crucial suggestion is to incorporate a control strategy into a future study and develop ways to ensure the proper interpretation of PCR results, while also enhancing the sensitivity of the Multiplex PCR method in the assessment of heterogeneous food samples [ 23 - 25 ].
Expressions of four AF biosynthetic pathway genes (aflD, aflO, aflP, and aflQ) were evaluated in 24 A. flavus strains by RT-PCR [ 21 ]. The results showed that transcription of the four genes was not always correlated with AF production, but there was a relationship between higher amounts of AFB1 production and expression of aflO and aflQ [ 21 ]. Rashmi et al. evaluated multiplex PCR assay for the concurrent detection of four major mycotoxin metabolic pathway genes, viz. nor1 (aflatoxin), Tri6 (trichothecene), FUM13 (fumonisin), and otanps (ochratoxin A) using 10 reference strains [ 25 ]. The concluded mPCR results were further evaluated with HPLC, and in general, both methods provided unequivocal results.
The five targeted AF cluster genes, namely aflD, aflR, aflS, aflM, and aflP were used for the examination of 15 aflatoxigenic isolates of A. flavus that were obtained from dairy feeds in Zimbabwe. Two genes, aflD and aflS, were significantly associated with aflatoxigenic A. flavus isolates [ 26 ]. The mycotoxigenic fungi belonging to various genera of Aspergillus spp., Alternaria spp., Penicillium spp., and Fusarium spp. were determined based on the eleven-primer pairs cocktail using multiplex PCR [ 27 ].
Conclusion
Detection of mycotoxin-producing fungi in an early stage is crucial for controlling mycotoxins from entering the food chain. Results of the present study indicated that multiplex PCR can be used as an accurate method for the detection of A. flavus strains that produce AFB1 in pistachio soil. Detection of aflatoxin biosynthesis nor1, ver-1, omtA, and aflR genes by multiplex PCR led to results that correlated significantly with the measurement of aflatoxin production by TLC and HPLC methods. The multiplex PCR assay could be a useful strategy to overcome the major problems of conventional mycotoxin analytical techniques, such as TLC and HPLC, with the aim of high‐throughput monitoring of major aflatoxin‐producing fungi during the processing steps of food and feed commodities.
Acknowledgments
This work was financially supported by the Research Deputy of Tarbiat Modares University with the Ethics Committee code of IR.MODARES. REC.1398.180.
Author’s contribution
M. S-G. conceived, designed, and supervised the study. A. D. performed the experiments and wrote the draft. M. S-G. and M.R-A designed the study, analyzed the data, and edited the manuscript draft. All authors read and approved the final version of the manuscript.
Conflicts of interest
The authors declare no conflict of interest.
Financial disclosure
No financial interests related to the material of this manuscript have been declared.
References
- Razzaghi-Abyaneh M, Chen ZY, Rai M, Shams-Ghahfarokhi M. Editorial: Community series in research efforts, challenges and opportunities in mitigating aflatoxins in food and agricultural crops and its global health impacts, volume II. Front Microbiol. 2023; 14:1141308.
- Caceres I, Khoury AA, Khoury RE, Lorber S, Oswald IP, Khoury AE, Atoui A, Puel O, Bailly JD. Aflatoxin Biosynthesis and Genetic Regulation: A Review. Toxins (Basel).. 2020; 28;12(3):150.
- Valasi L, Georgiadou M, Tarantilis PA, Yanniotis S, Pappas CS. Rapid screening on aflatoxins' presence in Pistachia vera nuts using diffuse reflectance infrared Fourier transform spectroscopy and chemometrics. J Food Sci Technol. 2021; 58(1):356-365.
- Razzaghi-Abyaneh M, Shams-Ghahfarokhi M, Allameh A, Kazeroon-Shiri A, Ranjbar-Bahadori S, Mirzahoseini H, Rezaee MB. A survey on distribution of Aspergillus section Flavi in corn field soils in Iran: population patterns based on aflatoxins, cyclopiazonic acid and sclerotia production. Mycopathologia. 2006; 161(3):183-92.
- Kumar A, Pathak H, Bhadauria S, Sudan J. Aflatoxin conta-mination in food crops: causes, detection, and management: a review. Food Production, Processing and Nutrition. 2021; 3:1-9.
- Georgianna DR, Payne GA. Genetic regulation of aflatoxin biosynthesis: from gene to genome. Fungal Genet Biol. 2009; 46(2):113-25.
- Yu J, Chang PK, Ehrlich KC, Cary JW, Bhatnagar D, Cleveland TE, Payne GA, Linz JE, Woloshuk CP, Bennett JW. Clustered pathway genes in aflatoxin biosynthesis. Appl Environ Microbiol. 2004; 70(3):1253-62.
- Chang PK, Horn BW, Dorner JW. Sequence breakpoints in the aflatoxin biosynthesis gene cluster and flanking regions in nonaflatoxigenic Aspergillus flavus isolates. Fungal Genet Biol. 2005; 42(11):914-23.
- Adhikari BN, Bandyopadhyay R, Cotty PJ. Degeneration of aflatoxin gene clusters in Aspergillus flavus from Africa and North America. AMB Express. 2016; 6(1):62.
- Aiko V, Mehta A. Occurrence, detection and detoxification of mycotoxins. J Biosci. 2015; 40(5):943-54.
- Shabeer S, Asad S, Jamal A, Ali A. Aflatoxin Contamination, Its Impact and Management Strategies: An Updated Review. Toxins (Basel).. 2022; 14(5):307.
- Azeez AZ, Hindi MT, Khudiar MM, Saadi AS, Khadim NI. Determination of Aflatoxins in Feed by HPLC and PCR. Journal of Food and Pharmaceutical Sciences. 2020; 315-23.
- Jamali M, Ebrahimi MA, Karimipour M, Shams-Ghahfarokhi M, Dinparast-Djadid N, Kalantari S, Pilehvar-Soltanahmadi Y, Amani A, Razzaghi-Abyaneh M. An insight into the distribution, genetic diversity, and mycotoxin production of Aspergillus section Flavi in soils of pistachio orchards. Folia Microbiol (Praha).. 2012; 57(1):27-36.
- Prasad K, Yogendra K, Sanivarapu H, Rajasekaran K, Cary JW, Sharma KK, Bhatnagar-Mathur P. Multiplexed Host-Induced Gene Silencing of Aspergillus flavus Genes Confers Aflatoxin Resistance in Groundnut. Toxins (Basel).. 2023; 15(5):319.
- Konietzny U, Greiner R. The application of PCR in the detection of mycotoxigenic fungi in foods. Braz J Microbiol. 2003; 34(4):283-300.
- Callicott KA, Cotty PJ. Method for monitoring deletions in the aflatoxin biosynthesis gene cluster of Aspergillus flavus with multiplex PCR. Lett Appl Microbiol. 2015; 60(1):60-5.
- Kim DM, Chung SH, Chun HS. Multiplex PCR assay for the detection of aflatoxigenic and non-aflatoxigenic fungi in meju, a Korean fermented soybean food starter. Food Microbiol. 2011; 28(7):1402-8.
- Callicott KA, Cotty PJ. Method for monitoring deletions in the aflatoxin biosynthesis gene cluster of Aspergillus flavus with multiplex PCR. Lett Appl Microbiol. 2015; 60(1):60-5.
- Criseo G, Bagnara A, Bisignano G. Differentiation of aflatoxin-producing and non-producing strains of Aspergillus flavus group. Lett Appl Microbiol. 2001; 33(4):291-5.
- Degola F, Berni E, Dall'Asta C, Spotti E, Marchelli R, Ferrero I, Restivo FM. A multiplex RT-PCR approach to detect aflatoxigenic strains of Aspergillus flavus. J Appl Microbiol. 2007; 103(2):409-17.
- Jamali M, Karimipour M, Shams-Ghahfarokhi M, Amani A, Razzaghi-Abyaneh M. Expression of aflatoxin genes aflO (omtB) and aflQ (ordA) differentiates levels of aflatoxin production by Aspergillus flavus strains from soils of pistachio orchards. Res Microbiol. 2013; 164(4):293-9.
- Kermani F, Shams-Ghahfarokhi M, Gholami-Shabani M, Razzaghi-Abyaneh M. Diversity, molecular phylogeny and fingerprint profiles of airborne Aspergillus species using random amplified polymorphic DNA. World J Microbiol Biotechnol. 2016; 32(6):96.
- Latha R, Manonmani HK, Rati ER. Multiplex PCR assay for the detection of aflatoxigenic and non-aflatoxigenic Aspergilli. Research Journal of Microbiology. 2008; 3(3):136-42.
- Geisen R. Multiplex polymerase chain reaction for the detection of potential aflatoxin and sterigmatocystin producing fungi. Systematic and Applied Microbiology. 1996; 19(3):388-92.
- Rashmi R, Ramana MV, Shylaja R, Uppalapati SR, Murali HS, Batra HV. Evaluation of a multiplex PCR assay for concurrent detection of four major mycotoxigenic fungi from foods. J Appl Microbiol. 2013; 114(3):819-27.
- Nleya N, Ngoma L, Adetunji MC, Mwanza M. Biodiversity of Aflatoxigenic Aspergillus Species in Dairy Feeds in Bulawayo, Zimbabwe. Front Microbiol. 2021; 11:599605.
- Al-Zaban MI, Alrokban AH, Mahmoud MA. Development of a real-time PCR and multiplex PCR assay for the detection and identification of mycotoxigenic fungi in stored maize grains. Mycology. 2023; 14(3):227-238.