Introduction
The most common invasive systemic mycosis agents in the world are Candida species, especially C.albicans [ 1 ]. C.albicans can survive in many different environmental conditions. Due to this ability, it can proliferate in many regions of the human body and may cause various diseases ranging from superficial infections to life-threatening serious infections, especially in immunocompromised patients [ 2 , 3 ].
Treatment of Candida infections usually requires long-term drug use. Azole antifungals are primarily preferred for treatment. As a result of long-term and repeated antifungal use, resistant Candida strains are encountered. When the studies conducted in the last 20 years on fluconazole susceptibility of C. albicans are analysed, it is seen that the resistance rate is gradually increasing [ 4 ]. In a study conducted in different European countries, it was found out that resistance to azole antifungal drugs and other antifungals develop over time [ 5 ]. Accordingly, antifungal resistance is likely to become an important public health problem in the future. Many mechanisms responsible for azole resistance in Candida strains have been suggested, and it has been determined that more than one mechanism play a significant role in fluconazole resistance. Among these mechanisms, modification in the lanosterol demethylase (ERG11p) and ergosterol biosynthesis is the most important. Another important mechanisms is the change in lanosterol demethylase (ERG11p) and ergosterol biosynthesis [ 6 ]. Other important factors include mutations in UPC2 (Zn2-Cys6 transcription factor uptake control) transcriptıon genes such as tac1 and mrr1 and overexpression of efflux pumps linked to CDR1, CDR2, MDR1, PDR16 and SNQ2 transporter genes [ 7 ].There are many virulence factors in Candida species. These factors may play a role in different body regions at different stages of infection. Some of the known virulence factors are adhesion, yeast-hyphae dimorphism, phenotypic transformation, biofilm formation, hydrolytic enzymes, survival at normal or febrile body temperature (37°-39°C), and rapid adaptation to microchanges in the host [ 8 ]. Although recent publications have shown that proteinase, one of the virulence factors of C. albicans, may be associated with fluconazole resistance, the relationship between the expression of SAP2, one of the most important proteinase genes, and drug resistance remains unclear [ 9 ]. The aim of this study was to investigate the fluconazole susceptibility and tolerance of C. albicans from clinical samples and their relationship with the expression levels of ERG11/ SAP2 genes and proteinase activity.
Materials and Methods
C. albicans strains isolated from various clinical specimens sent to the Medical Microbiology Laboratory of Düzce University Medical Faculty between 01.08.2021 and 01.08.2022 were included in this study. In case of more than one sample from the same patient, the strains isolated from the first sample were used. Furthermore, an ethical clearance was obtained from Düzce University Non-Interventional Health Research Ethics Committee with decision number 2022/133 on 04.07.2022 prior to the conduct of the study.
Identification of Candida albicans strains
The patient samples were inoculated on Sabouraud Dextrose agar (SDA) (Condalab, Spain) medium, then placed in Eppendorf tubes containing brain-heart infusion broth (Plasmatec, UK). After 24 hours of incubation, the media were stored at -20°C until the commencement of the study. On the first day of the study, the Eppendorf tubes were kept at 37°C for 2 hours and inoculated on SDA medium and incubated at the same temperature for 18-24 hours. After the incubation period, the strains were identified using germ tube test, microscopic evaluation on corn flour-tween 80 agar by Dalmau plate method, growth characteristics on chromogenic medium, and Vitek 2 (bioMerieux, France) automated system were used [ 2 , 10 ].
Determination of proteinase activity
Detection of proteinase activity was done using the enzyme activity of SAP by the yeast nitrogen base-bovine serum albumin YNB–BSA agar plate method [ 11 ]. Proteinase activity was tested using two different media. The first medium used was 1% bovine serum albumin (BSA) (Sigma-Aldrich, USA). For this purpose, a medium containing 2 g of BSA, 1.45 g of YNB (Difco Laboratories, Detroit, MI, USA), 20 g of glucose and 20 g of agar in one liter of distilled water was prepared [ 11 , 12 ]. Agar and glucose were mixed in 900 ml of distilled water and sterilized in an autoclave. Afterwhich, BSA and YNB were dissolved in 100 ml of distilled water and passed through a 0.22 μm paper filter (Isolab, Turkey). It was added to the first mixture, which was removed from the autoclave and cooled at 50 °C. For the second media, the same medium was used. However, 1 g KH2PO4 and 0.5 g MgSO4.7 H2O were added used in addition to the components of the first medium. Afterwhich, the medium was sterilized using an autoclave. The sterile media were poured into 9 cm petri dishes and stored at 4 °C. Additinally, a clinical isolate of C. albicans with known antibiogram profile (C. albicans ATCC 90028 strain) was used as positive control for the isolates.
Stock cultures for the yeast strains to be tested were inoculated on SDA medium. They were incubated at 37 °C for 24 hours. Pure colonies were taken using a sterile a loop and suspended on sterile distilled water. Afterwhich, the solution was standardized using 0.5 McFarland. 10 microliters of this suspension were taken with a micropipette and placed in a medium with a maximum of 4 strains, and the medium was incubated at 37 °C for 1 week. The diameters of the zone of inhibition at the end of the incubation period and the transparent zone formed around it due to protein degradation were measured. Proteinase activity was determined by the ratio of the sum of the colony diameter and the transparent zone diameter formed around the colony to the colony diameter and expressed as the Prz value. The Prz value was evaluated as negative if it was 1.0; 1+ if it was 0.9-1; 2+ if it was 0.89-0.8; 3+ if it was 0.79-0.7; and 4+ if it was ≤ 0.69 [ 13 ].
Antifungal susceptibility test for fluconazole
Antifungal susceptibilities of the strains included in the study were analysed and interpreted according to the recommendations of EUCAST E.DEF 7.3.2 guideline, which is one of the reference methods in broth microdilution method. For fluconazole, MIC values of ≥ 8 µg/ml was considered as resistant (R), 4 µg/ml as dose-dependent susceptible (DDS) and ≤ 2 µg/ml as susceptible (S) [ 14 ]. On the, the 24th hour of incubation, the MIC values of the strains were recorded. Afterwhich, the incubation period was extended to 48 hours in order to evaluate their tolerance and re-evaluation was performed at the end of 48 hours.
Quantitative Reverse Transcriptase Polymerase Chain Reaction (qRT-PZT)
Hybrid-RTM (GeneAll®, Korea) kit was used for RNA isolation from the strains in accordance with the manufacturer's recommendations. After RNA isolation, cDNA synthesis phase was started. cDNA Synthesis Kit (A.B.T.TM, Turkey) was used for cDNA synthesis. After obtaining cDNA, real-time qPCR was performed. For this, 2X qPCR SYBR-Green MasterMix (A.B.T.TM, Turkey) kit was used. ACT1 was used as the housekeeping gene and Candida albicans ATCC 90028 was used as the reference strain. The primer sequences used in this study are shown in Table 1.
| Primer name | Primer sequence (5'-3') |
|---|---|
| ERG11-F | ACTCATGGGGTTGCCAATGTT |
| ERG11-R | GAGCAGCATCACGTCTCCAA |
| ACT1-F | AGGTTTGGAAGCTGCTGGTA |
| ACT1-R | ACGTTCAGCAATACCTGGGA |
| SAP2-F | AACAACAACCCACTAGACATCACC |
| SAP2-R | TGACCATTAGTAACTGGGAATGCTTTAGGA |
Relative quantitation calculation
Relative expressions were calculated by the ΔΔCT method. ACT1 gene was used as a reference and C. albicans ATCC 90028 strain was used for normalization.
Statistical Analyses
Statistical evaluation of the data was done with IBM SPSS v.22 (IBM Corp. Released 2013. IBM SPSS Statistics for Windows, Version 22.0. Armonk, NY: IBM Corp.) package program. The distribution of numerical data was examined with the Kolmogorov-Smirnov test, the Mann-Whitney U test was used in group comparisons, and the analysis of categorical data was done with the Fisher-Freeman-Halton test. Spearman’s rho was used for correlation analysis. Descriptive statistics of numerical data are presented as median value, minimum-maximum, and categorical data are presented as numbers and percentages, and 0.5 level of significance was used.
Results
A total of 127 C. albicans strains were evaluated in this study. 79 (62%) of the samples belonged to female and 48 (38%) to male patients. The age range of the patients was 0-93 years with a mean age of 55.8 years and a median value of 63 years. In this study, 56 (45%) yeasts were isolated from inpatient wards, 47 (37%) from outpatient clinics and 24 (18%) from intensive care units. In this study, comparison of Candida strains from both outpatients or inpatients was not considered. The distribution of the studied yeasts according to sample type is shown in Table 2.
| Sample type | Number | % | p |
|---|---|---|---|
| Urine | 84 | 66.1 | p<0.001 |
| Vagina | 17 | 13.3 | |
| Sputum | 12 | 9.4 | |
| Blood | 3 | 2.3 | |
| Wound | 3 | 2.3 | |
| DTA* | 3 | 2.3 | |
| Blood catheter | 1 | 0.78 | |
| BAL** | 1 | 0.78 | |
| Peritoneum | 1 | 0.78 | |
| Pleura | 1 | 0.78 | |
| Abscess | 1 | 0.78 | |
| Total | 127 | 100 | |
| * Deep Tracheal Aspirate, ** Bronchoalveolar Lavage | |||
A broth microdilution antifungal susceptibility test was performed on 127 isolated C. albicans strains. The evaluation performed with spectrophotometric microplate reader at 24 hours showed that 123 (96.86%) of the strains were susceptible to fluconazole while four strains (3.14%) were resistant. The distribution of the strains according to MIC values is presented given in Table 3. Accordingly, 38 (29.92%) of 127 strains showed an increase in MIC values, while 89 (70.08%) showed no change in MIC values. There were 3 strains that switched from susceptible profile to dose-dependent susceptible profile after MIC values increased. In two of the fluconazole resistant strains, MIC values increased by one dilution, while no change was observed in the others.
| MIC value | Number (n=127) | % | |
|---|---|---|---|
| n | % | ||
| 0.125 | 63 | 49.60 | *96.86 |
| 0.25 | 46 | 36.22 | |
| 0.5 | 7 | 5.51 | |
| 1 | 4 | 3.14 | |
| 2 | 3 | 2.36 | |
| 16 | 3 | 2.36 | **3.14 |
| 32 | 1 | 0.78 | |
| *Ratio of susceptible strains, **Ratio of resistant strains | |||
Proteinase positivity was detected in 103 (81.11%) of 127 strains included in the study. The classification of the strains according to the level of proteinase activity is shown in Table 4. Proteinase levels of the strains included in the study were compared with fluconazole susceptibility values, but no statistically significant relationship was found between them (p=0.718). The comparison of proteinase levels of the strains according to their susceptibility to fluconazole is shown in Table 5.
| Proteinase activity | Number (n) | % |
|---|---|---|
| 4+ | 91 | 71.65 |
| 3+ | 11 | 8.66 |
| 2+ | 0 | 0 |
| 1+ | 1 | 0.78 |
| Negative | 24 | 18.89 |
| Proteinase value | Fluconazole susceptibility | Total | p | |
|---|---|---|---|---|
| S | R | |||
| No | 24 | 0 | 24 | 0.718 |
| 1+ | 1 | 0 | 1 | |
| 3+ | 11 | 0 | 11 | |
| 4+ | 87 | 4 | 91 | |
ERG11 and SAP2 gene expression levels of 44 strains randomly selected from 127 strains were investigated by qPCR. When the ERG11 expression levels of 44 strains were analysed, it was observed that 25 strains expressed more ERG11 and 14 strains expressed less ERG11 compared to ATCC strains. ERG11 expression was not observed in five strains. When the SAP2 expression levels of 44 PCR strains were analysed, it was found that 13 strains expressed more SAP2 and 12 strains expressed less SAP2 compared to the ATCC strain, while no SAP2 expression was observed in 19 strains. The fold changes of the strains with higher expression levels compared to ATCC are shown in Table 6. According to PCR results a moderate positive correlation was detected between ERG11 and SAP2 expression levels in a total of 11 strains that expressed both ERG11 and SAP2 more than the ATCC strain and in a total of 26 strains that showed both ERG11 and SAP2 positivity. (p=0.029, r:0.655, p<0.001). When the relationship between ERG11, SAP2 expression levels of the strains and fluconazole susceptibility was examined, no statistically significant relationship was found between them (Table 7). There was a significant correlation between fluconazole MIC elevation at 48. hours and ERG11 expression levels (p=0.037), while no significant correlation was found between fluconazole MIC elevation and SAP2 levels at the end of the same period. There was no significant difference between ERG11 and SAP2 expression in a total of 44 strains for which PCR could be performed, 19 of which produced no proteinase and 25 produced 4+ proteinase (Table 8).
| Strain number | ERG11 floor change | SAP 2 fold change |
|---|---|---|
| 6 | 2.4 | - |
| 16 | 1.19 | 1.3 |
| 29 | 333.15 | 168.9 |
| 45 | - | 1.04 |
| 63 | 1.06 | - |
| 67 | 2.05 | 4.4 |
| 94 | 3.42 | - |
| 128 | 4.41 | 4.23 |
| 206 | 2.59 | 2.38 |
| 325 | 5 | - |
| 384 | 1.91 | 1.35 |
| 391 | 2.21 | - |
| 416 | 2.7 | - |
| 464 | 67.65 | - |
| 483 | 3.79 | - |
| 486 | 1.34 | 1.39 |
| 496 | 5.98 | 2.8 |
| 546 | 10.71 | 2.08 |
| 577 | 1.04 | - |
| 613 | 2.48 | 46.21 |
| 629 | 11.96 | - |
| 633 | 1.25 | - |
| 635 | - | 1.43 |
| 638 | 1.01 | - |
| 645 | 4.09 | - |
| 712 | 72.01 | 12.82 |
| 721 | 15.14 | - |
| Expression type | Expression status (n) | Fluconazole susceptibility | p | |
|---|---|---|---|---|
| S | R | |||
| ERG11 expression | Negative (5 ) | 5 | 0 | >0.999 |
| Less than ATCC (14 ) | 13 | 1 | ||
| More than ATCC (25) | 22 | 3 | ||
| Total (44) | 40 | 4 | ||
| SAP2 expression | Negative (16 ) | 15 | 1 | 0.600 |
| Less than ATCC (15) | 14 | 1 | ||
| More than ATCC (13) | 11 | 2 | ||
| Total | 40 | 4 | ||
| Expression type | Feature (n) | Presence of proteinase (n) | p | |
|---|---|---|---|---|
| No | 4+ | |||
| SAP2 expression | Negative (16) | 9 | 7 | 0.409 |
| Less than ATCC (15) | 5 | 10 | ||
| More than ATCC (13) | 5 | 8 | ||
| Toplam (44) | 19 | 25 | ||
| ERG11 expression | Negative (5) | 2 | 3 | 0.415 |
| Less than ATCC (14) | 4 | 10 | ||
| More than ATCC (15) | 13 | 12 | ||
| Toplam (44) | 19 | 25 | ||
Discussion
Nowadays, due to the widespread use of broad-spectrum antibiotics and immunosuppressive drugs, prolonged neutropenia due to cytotoxic therapy, increased catheter use, and interventional procedures such as major cardiac and abdominal surgery, Candida species are at the forefront of opportunistic nosocomial infection agents [ 15 ]. The problem of antifungal resistance observed as a result of the increased use of antifungal drugs due to this increase in Candida infections has accelerated studies investigating the mechanisms of resistance to these drugs [ 16 ]. Azole antifungals are frequently used in the treatment of C. albicans infections. However, resistance to azoles may develop with long-term use. Wang et al. [ 17 ] reported fluconazole resistance rate in C. albicans strains as 4.16% in an antifungal resistance surveillance study conducted in China in 2022. In a study conducted in the USA with 621 C. albicans strains, the fluconazole resistance rate was found to be 0.5% [ 18 ], Tiryaki et al. [ 19 ] did not find any fluconazole-resistant C. albicans strains in a study on Candida strains isolated from various patient samples. Erdem et al. [ 20 ] found the fluconazole resistance rate in C. albicans strains to be 1.6% in a study on hospital infections in 2012. In this study, the fluconazole resistance rate in C. albicans strains was found to be 3.16%. The resistance of C. albicans to azoles in this study was found to be higher compared to the results of Wang et al. [ 17 ]. This may be due to the antifungal use policies of the institutions where the studies were conducted.
Azole antifungals work by targetıng 14-alpha demethylase enzyme, which is controlled by the ERG11 gene in the ergosterol biosynthesis pathway in fungal cells. Ergosterol is an important component of the fungal cell membrane. Interruption of its synthesis leads to the accumulation of 14a-methyl sterols. This inhibits membrane stability, permeability, and the activity of membrane-bound enzymes. Overexpression of the ERG11 gene is considered one of the common azole resistance mechanisms in C. albicans strains [ 21 , 22 ]. In a study conducted in 2022, Suchodolski et al. [ 22 ] reported that increased ERG11 expression in C. albicans contributed to increased ergosterol production and increased drug resistance of strains. In a study conducted by Feng et al. [ 23 ] in 2016, they found that ERG11 expression was significantly higher in fluconazole-resistant strains of C. albicans compared to susceptible strains and reported that resistance to azoles in C. albicans isolates may be associated with mutations in the ERG11 gene. Franz et al. [ 21 ] found that increased ERG11 expression levels were correlated with fluconazole resistance in their study with azole-resistant C. albicans strains. Some studies have shown that there is no significant relationship between ERG11 overexpression and azole resistance [ 24 , 25 ]. For example, Park and Perlin [ 24 ] found the ERG11 overexpression rate to be 12% in their study with 32 azole-resistant C. albicans strains and found no statistically significant correlation with azole resistance. White et al. [ 25 ] found no significant correlation between ERG11 expression and fluconazole resistance in their study with equal numbers of fluconazole-sensitive and -resistant strains. They also stated that ERG11 gene mutation is frequently seen in C. albicans strains and is not reliably associated with resistance, and that the mechanisms causing azole resistance phenotype may be diverse. In our study, when the relationship between the numerical values of ERG11 expression and fluconazole susceptibility of 25 of 44 C. albicans strains that were found to express more ERG11 than ATCC strains was examined, no statistically significant difference was found between ERG11 expression and fluconazole resistance. Considering the mutations mentioned in the literature and the existence of different resistance mechanisms, it was thought that further studies using a large number of resistant Candida strains could contribute more to the determination of the relationship between ERG11SAP2, an important virulence factor for C. albicans, can provide nutrients for its own growth by degrading macromolecular proteins on the mucosal surface and also increases the ability of C. albicans to adhere to and invade the host. In a study conducted by Gerges et al. [ 26 ] with 181 C. albicans strains, SAP2 gene expression was detected in 69.6% of the strains by RT-qPCR analysis and a significant relationship was found between proteinase production and fluconazole resistance. In this study, it was observed that 13 (29.5%) of 44 C. albicans strains that were found to express SAP2 more than ATCC strains had no significant relationship with fluconazole sensitivity. In addition, when the expression levels of 26 strains showing ERG11 and SAP2 positivity were examined, a moderate positive correlation was observed between ERG11 and SAP2 values, similar to the study of Feng et al. [ 9 ]. It is thought that ERG11 and SAP2 may have a certain relationship in the formation of antifungal resistance in C. albicans and may act together in the emergence of resistance to azole drugs. Since the number of azole-resistant strains in this study was low, no significant correlation was found between the numerical values of SAP2 expression and fluconazole sensitivity of the strains that were found to express more SAP2 than the control strains.
Proteinases mediate very important biological activities such as hyphae production, adhesion and invasion in Candida infection [ 27 ]. In various studies, the presence of proteinase in C. albicans strains varies between 57-81% [ 13 , 26 , 28 - 30 ]. In this study, proteinase positivity was detected in 103 of 127 strains (81.11%). 71.65% of the strains were found to have strong, 8.66% moderate and 0.78% weak proteinase activity.
The ability of C. albicans to produce extracellular enzymes may contribute to its virulence. It can produce different enzymes, and their amount and potency vary depending on the site of isolation [ 31 ]. Garaghani et al. [ 32 ] detected high and moderate levels of proteinase activity in 97.1% of C. albicans strains isolated from vulvovaginal samples and found no significant difference in proteinase activity among genotypes [ 33 ]. Another study found that an aspartyl proteinase secreted by C. albicans, in addition to its protease activity, contains the RGD (RGDRGD) motif required for binding to host integrins and activates immune cells to induce proinflammatory cytokines. In this way, it has been reported that C. albicans can penetrate deeper into the oral mucosa and spread systemically by taking advantage of the disruption of intercellular connections [ 33 ].The presence of proteinase in this study was found to be consistent with the literature and no significant relationship was found between fluconazole sensitivity and proteinase presence. Studies examining the relationship between ERG11 expression levels and proteinase activity of strains are limited. Said et al. [ 34 ] found a positive correlation between proteinase activity and ERG11 expression levels in fluconazole-resistant Candida strains. However, no statistically significant relationship was found between the numerical values of proteinase activity of the strains and ERG11 expression levels in this study (p=0.126). By increasing the number of resistant strains, different result may be obtained in future studies.
Antifungal tolerance refers to the ability of fungal cells to survive in the presence of drug concentrations sufficient to inhibit cell growth, i.e., drug concentrations above the MIC breakpoint. Tolerance to azole agents is important because it limits the effectiveness of drug treatments [ 35 ]. Mashaly et al. [ 28 ] found a fluconazole tolerance rate of 33% in a study conducted in Egypt with 88 C. albicans isolates in 2022. In this study, no strain has been found to switch from a susceptible profile to a resistant profile among the isolated strains after 48 hours of extended incubation. However, three strains has been found to switched from a susceptible profile to a 'dose-dependent susceptible' profile. This results showed that fluconazole tolerance is low in the area where the study is conducted.
Moreover, the inability to distinguish the infectious agent or colonization of the strains included in the study, the inability to perform ERG11 and SAP2 PCR tests on all strains due to insufficient financial resources, and the small number of fluconazole-resistant strains were not considered in this study.
Conclusion
In conclusion, in addition to the moderate positive correlation between ERG11 and SAP2 values, a significant correlation was found between ERG11 expression and fluconazole tolerance. Considering that the presence of proteinase is a virulence factor in C. albicans strains, these results support the idea that large scale studies are needed to determine the relationship between the SAP family and antifungal resistance as well as the relationship between ERG11 and SAP2 values.
Acknowledgements
None.
Authors’ Contribution
E.N. contributed to the conceptualization, methodology, validation, investigation, and writing of the original draft. Ö.Ş. was responsible for conceptualization, supervision, management, and coordination of the research activity planning and execution. A.E. contributed to writing, review, editing, and visualization. Ç.E. was involved in data curation, writing, review, and editing. S.MA. performed the formal analysis.
Conflict of interest
The authors declare no conflicts of interest.
Financial Disclosure
Our research was supported by Düzce University Scientific Research Projects Commission with the project number 2022.04.01.1354.
References
- Azie N, Neofytos D, Pfaller M, Meier-Kriesche HU, et al. The PATH (Prospective Antifungal Therapy) Alliance® registry and invasive fungal infections: update 2012. Diagn Microbiol Infect Dis. 2012; 73(4):293-300.
- Walsh TH, Hayden RT, Larone DH. Yeast and Yeast Like Organisms. Medically Important Fungi: A Guide to Identification. Washington, DC: American Society for Microbiology Press; 2002.
- Howell SA, Hazen KC, Brandt ME. Candida, Cryptococcus, and other yeasts of medical importance. Manual of clinical microbiology. 2015;1984-2014.
- Lee MK, Kim HR, Kang JO, Kim MN, et al. Susceptibility and trailing growth of Candida albicans to fluconazole: results of a Korean multicentre study. Mycoses. 2007 Mar; 50(2):148-9.
- Odoj K, Garlasco J, Pezzani MD, Magnabosco C, et al. Tracking Candidemia Trends and Antifungal Resistance Patterns across Europe: An In-Depth Analysis of Surveillance Systems and Surveillance Studies. J Fungi (Basel). 2024; 10(10):685.
- GÜLAT S, DERELİ MD. Flukonazole Dirençli Candida albicans İzolatlarında Atım Pompa Ekspresyonlarının Araştırılması. Mikrobiyol Bul. 2014; 48(2):325-34.
- Czajka KM, Venkataraman K, Brabant-Kirwan D, Santi SA, et al. Molecular Mechanisms Associated with Antifungal Resistance in Pathogenic Candida species. Cells. 2023 ; 12(22):2655.
- Naglik JR, Challacombe SJ, Hube B. Candida albicans secreted aspartyl proteinases in virulence and pathogenesis. Microbiol Mol Biol Rev. 2003 ; 67(3):400-28.
- Feng W, Yang J, Ma Y, Xi Z, et al. The effects of secreted aspartyl proteinase inhibitor ritonavir on azoles‐resistant strains of Candida albicans as well as regulatory role of SAP2 and ERG11. Immun Inflamm Dis. 2021; 9(3):667-80.
- Procop W, Church DL, Geraldine S. Hall, William M. Janda, Elmer W. Koneman, Paul C. Schreckenberger, et al. Koneman’s Color Atlas and Textbook of Diagnostic Microbiology. 2017.
- Li W, Yu D, Gao S, Lin J, et al. Role of Candida albicans-secreted aspartyl proteinases (Saps) in severe early childhood caries. Int J Mol Sci. 2014; 15(6):10766-79.
- Barros L.M, Boriollo MF.G, Alves AC.B.A, Klein M.I, et al. Genetic diversity and exoenzyme activities of Candida albicans and Candida dubliniensis isolated from the oral cavity of Brazilian periodontal patients. Arch Oral Biol. 2008; 53(12):1172-8.
- Yenişehirli G, Bulut Y, Tunçoglu E. Phospholipase, proteinase and hemolytic activities of Candida albicans isolates obtained from clinical specimens. Mikrobiyol Bul. 2010; 44(1):71-7.
- European committee on antimicrobial susceptibility testing. Breakpoint Tables for Interpretation of MICs and Zone Diameters. Version 10.0. 2020.
- CİLO BD, TOPAÇ T, AĞCA H, SAĞLAM S, et al. Candida İzolatlarının Antifungal Duyarlılığının Belirlenmesinde Klinik Laboratuvar Standartları Enstitüsü (CLSI) ve Avrupa Antimikrobiyal Duyarlılık Testleri Komitesi (EUCAST) Sıvı Mikrodilüsyon Yöntemlerinin Karşılaştırılması. Mikrobiyol Bul. 2018; 52(1):35-48.
- Kamai Y, Maebashi K, Kudoh M, Makimura K. Characterization of mechanisms of fluconazole resistance in a Candida albicans isolate from a Japanese patient with chronic mucocutaneous candidiasis. Microbiol Immunol. 2004; 48(12):937-43.
- Wang Q, Cai X, Li Y, Zhao J, et al. Molecular identification, antifungal susceptibility, and resistance mechanisms of pathogenic yeasts from the China antifungal resistance surveillance trial (CARST-fungi) study. Front Microbiol. 2022; 13:1006375.
- Pfaller MA, Rhomberg PR, Messer SA, Jones RN, et al. Isavuconazole, micafungin, and 8 comparator antifungal agents' susceptibility profiles for common and uncommon opportunistic fungi collected in 2013: temporal analysis of antifungal drug resistance using CLSI species-specific clinical breakpoints and proposed epidemiological cutoff values. Diagn Microbiol Infect Dis. 2015; 82(4):303-13.
- Tiryaki Y, Korkmazgil G, Eyigör M, Aydın N. The use of polymerase chain reaction in laboratory diagnosis of dermatophytosis. Mikrobiyol Bul. 2015; 49(2):201-9.
- Erdem F, Tuncer EG, Oral B, Karakoç E, et al. Candida türlerine bağlı nozokomiyal enfeksiyonların epidemiyolojik ve mikrobiyolojik açıdan değerlendirilmesi. Mikrobiyol Bul. 2012; 46(4):637-48.
- Franz R, Kelly SL, Lamb DC, Kelly DE, et al. Multiple molecular mechanisms contribute to a stepwise development of fluconazole resistance in clinical Candida albicans strains. Antimicrob Agents Chemother. 1998; 42(12):3065-72.
- Suchodolski J, Muraszko J, Korba A, Bernat P, et al. Lipid composition and cell surface hydrophobicity of Candida albicans influence the efficacy of fluconazole–gentamicin treatment. Yeast. 2020; 37(1):117-29.
- Feng W, Yang J, Xi Z, Qiao Z, et al. Mutations and/or overexpressions of ERG4 and ERG11 genes in clinical azoles-resistant isolates of Candida albicans. Microb Drug Resist. 2017; 23(5):563-70.
- Park S, Perlin DS. Establishing surrogate markers for fluconazole resistance in Candida albicans. Microb Drug Resist. 2005; 11(3):232-8.
- White TC, Holleman S, Dy F, Mirels LF, et al. Resistance mechanisms in clinical isolates of Candida albicans. Antimicrob Agents Chemother. 2002; 46(6):1704-13.
- Gerges MA, Fahmy YA, Hosny T, Gandor NH, et al. Biofilm Formation and Aspartyl Proteinase Activity and Their Association with Azole Resistance Among Candida albicans Causing Vulvovaginal Candidiasis, Egypt. Infect Drug Resist. 2023;5283-93.
- Sundstrom P. Adhesion in Candida spp. Cell Microbiol. 2002; 4(8):461-9.
- Mashaly GE, Zeid MS. Candida albicans genotyping and relationship of virulence factors with fluconazole tolerance in infected pediatric patients. Infect Drug Resist. 2022;2035-43.
- Patil S, Ugargol AR, Ns S. Comparıson of Two Methods or Detection of Secreted Aspartyl Proteinase in Urinary Isolates of Candida species. Natl J Med Res. 2014; 4 (2):119-21.
- Oksuz S, Sahin I, Yildirim M, Gulcan A, et al. Phospholipase and proteinase activities in different Candida species isolated from anatomically distinct sites of healthy adults. Jpn J Infect Dis. 2007; 60(5):280-3.
- Jafarian H, Gharaghani M, Seyedian SS, Mahmoudabadi AZ. Genotyping, antifungal susceptibility, enzymatic activity, and phenotypic variation in Candida albicans from esophageal candidiasis. J Clin Lab Anal. 2021; 35(7):e23826.
- Gharaghani M, Shabanzadeh M, Jafarian H, Zarei Mahmoudabadi A. ABC typing and extracellular enzyme production of Candida albicans isolated from Candida vulvovaginitis. J Clin Lab Anal. 2022; 36(1):e24117.
- Kumar R, Rojas IG, Edgerton M. Candida albicans Sap6 initiates oral mucosal inflammation via the protease activated receptor PAR2. Front Immunol. 2022; 13:912748.
- El Said M, Badawi H, Gamal D, Salem D, et al. Detection of ERG11 gene in fluconazole resistant urinary Candida isolates. Egypt J Immunol. 2022 ; 29(4):134-47.
- Sanglard D, Odds FC. Resistance of Candida species to antifungal agents: molecular mechanisms and clinical consequences. Lancet Infect Dis. 2002; 2(2):73-85.